sequence-based reagent qpcr met exon 17 (forward primer) Search Results


99
Thermo Fisher model 380b dna synthesizer
Model 380b Dna Synthesizer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/model 380b dna synthesizer/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
model 380b dna synthesizer - by Bioz Stars, 2026-02
99/100 stars
  Buy from Supplier

90
Illumina Inc amplicon sequencing
Amplicon Sequencing, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/amplicon sequencing/product/Illumina Inc
Average 90 stars, based on 1 article reviews
amplicon sequencing - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Eurofins sequence-based reagent qpcr met exon 17 (forward primer)

Sequence Based Reagent Qpcr Met Exon 17 (Forward Primer), supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequence-based reagent qpcr met exon 17 (forward primer)/product/Eurofins
Average 90 stars, based on 1 article reviews
sequence-based reagent qpcr met exon 17 (forward primer) - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Eurofins cxcr4 (reverse primer

Cxcr4 (Reverse Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cxcr4 (reverse primer/product/Eurofins
Average 90 stars, based on 1 article reviews
cxcr4 (reverse primer - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Eurofins cxcl12 (reverse primer

Cxcl12 (Reverse Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cxcl12 (reverse primer/product/Eurofins
Average 90 stars, based on 1 article reviews
cxcl12 (reverse primer - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Eurofins sequence- based reagent

Sequence Based Reagent, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequence- based reagent/product/Eurofins
Average 90 stars, based on 1 article reviews
sequence- based reagent - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
baseclick GmbH edu

Edu, supplied by baseclick GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/edu/product/baseclick GmbH
Average 90 stars, based on 1 article reviews
edu - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Eurofins pax7creert2fan (primer 1

Pax7creert2fan (Primer 1, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pax7creert2fan (primer 1/product/Eurofins
Average 90 stars, based on 1 article reviews
pax7creert2fan (primer 1 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Eurofins β-actin (reverse primer

β Actin (Reverse Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/β-actin (reverse primer/product/Eurofins
Average 90 stars, based on 1 article reviews
β-actin (reverse primer - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Millipore goat polyclonal anti- collageniv

Goat Polyclonal Anti Collageniv, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/goat polyclonal anti- collageniv/product/Millipore
Average 90 stars, based on 1 article reviews
goat polyclonal anti- collageniv - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Millipore rabbit polyclonal anti- laminin

Rabbit Polyclonal Anti Laminin, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit polyclonal anti- laminin/product/Millipore
Average 90 stars, based on 1 article reviews
rabbit polyclonal anti- laminin - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Developmental Studies Hybridoma Bank mouse monoclonal anti- sarcomeric myosin

Mouse Monoclonal Anti Sarcomeric Myosin, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse monoclonal anti- sarcomeric myosin/product/Developmental Studies Hybridoma Bank
Average 90 stars, based on 1 article reviews
mouse monoclonal anti- sarcomeric myosin - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

Image Search Results


Journal: eLife

Article Title: Met and Cxcr4 cooperate to protect skeletal muscle stem cells against inflammation-induced damage during regeneration

doi: 10.7554/eLife.57356

Figure Lengend Snippet:

Article Snippet: Sequence-based reagent , CATTTTGGCTGTGTCTATCATG , Eurofins , N/A , qPCR Met Exon 17 (forward primer).

Techniques: In Situ, SYBR Green Assay, Sequencing